ID: 959476246_959476249

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 959476246 959476249
Species Human (GRCh38) Human (GRCh38)
Location 3:106815504-106815526 3:106815537-106815559
Sequence CCCCTGTTAGATAAATTCTTCAA TATTTTTTTCATAGAAGCTTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 214} {0: 1, 1: 0, 2: 2, 3: 53, 4: 567}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!