ID: 959643002_959643005

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 959643002 959643005
Species Human (GRCh38) Human (GRCh38)
Location 3:108662924-108662946 3:108662951-108662973
Sequence CCAAGAAGTCTAGTTTAAAATCC CAGTTTCTAGAATGCTGATAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 256} {0: 1, 1: 0, 2: 2, 3: 9, 4: 195}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!