ID: 959677757_959677763

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 959677757 959677763
Species Human (GRCh38) Human (GRCh38)
Location 3:109055701-109055723 3:109055733-109055755
Sequence CCCTGTTCCAGGAACTAAGAATA CCAGAAATACAGGTTCCCCCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 5, 3: 35, 4: 320} {0: 1, 1: 0, 2: 1, 3: 8, 4: 138}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!