ID: 959868581_959868587

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 959868581 959868587
Species Human (GRCh38) Human (GRCh38)
Location 3:111300377-111300399 3:111300408-111300430
Sequence CCTAAGTGCACAAATTCTATCTA ATGGCTGCTACCAAGGGATGGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 5, 3: 90, 4: 343} {0: 1, 1: 0, 2: 8, 3: 51, 4: 352}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!