ID: 959922156_959922165

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 959922156 959922165
Species Human (GRCh38) Human (GRCh38)
Location 3:111880260-111880282 3:111880295-111880317
Sequence CCTGAAAGGTCGTTAGGACCCCC AGAATTAGAGATATGTTTGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 102} {0: 1, 1: 1, 2: 3, 3: 38, 4: 315}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!