ID: 959956533_959956535

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 959956533 959956535
Species Human (GRCh38) Human (GRCh38)
Location 3:112244749-112244771 3:112244767-112244789
Sequence CCTAGCTAGTCTTCTGTTCTGTA CTGTATCCACAGATGGAATTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 249} {0: 1, 1: 0, 2: 2, 3: 18, 4: 176}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!