|
Left Crispr |
Right Crispr |
| Crispr ID |
959963884 |
959963891 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
3:112332565-112332587
|
3:112332608-112332630
|
| Sequence |
CCTGGACCACAGAGCGAGACTCC |
GAGAAGAAGGAGAAGGAGAAGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 18, 1: 1484, 2: 33479, 3: 88856, 4: 142137} |
{0: 3, 1: 38, 2: 202, 3: 1151, 4: 5083} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|