ID: 960057741_960057744

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 960057741 960057744
Species Human (GRCh38) Human (GRCh38)
Location 3:113287202-113287224 3:113287220-113287242
Sequence CCAGGCACATGGTTCATCACGAG ACGAGCATGAGGGAACAGCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 65} {0: 1, 1: 0, 2: 1, 3: 12, 4: 170}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!