ID: 960308979_960308981

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 960308979 960308981
Species Human (GRCh38) Human (GRCh38)
Location 3:116097592-116097614 3:116097625-116097647
Sequence CCATGAGTAAATAAGTAAGTAAT TCAGGACTACCATTAGAAAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 43, 4: 356} {0: 1, 1: 0, 2: 0, 3: 12, 4: 156}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!