ID: 960465963_960465982

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 960465963 960465982
Species Human (GRCh38) Human (GRCh38)
Location 3:117997079-117997101 3:117997129-117997151
Sequence CCCTGTTCCATCCAGAACCGGAG AGCCCGGCGGCAGGGAGGAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 84} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!