ID: 960500359_960500361

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 960500359 960500361
Species Human (GRCh38) Human (GRCh38)
Location 3:118430462-118430484 3:118430508-118430530
Sequence CCTTATACATTCTGGATATCAGA AAATATTTTCTCCCATTCTGTGG
Strand - +
Off-target summary No data {0: 1067, 1: 2377, 2: 3404, 3: 4287, 4: 3840}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!