ID: 960864368_960864377

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 960864368 960864377
Species Human (GRCh38) Human (GRCh38)
Location 3:122184570-122184592 3:122184588-122184610
Sequence CCTGGTGGGGGAGGGGCCGTGGC GTGGCGGGGTCTGGGGGCCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 65, 4: 610} {0: 1, 1: 0, 2: 5, 3: 64, 4: 663}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!