ID: 960914265_960914278

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 960914265 960914278
Species Human (GRCh38) Human (GRCh38)
Location 3:122680862-122680884 3:122680908-122680930
Sequence CCGGCGGAGAGCGGAGCTGAGGA CTGCTGGTCGAGGGCTCCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 13, 4: 156} {0: 1, 1: 0, 2: 1, 3: 16, 4: 147}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!