ID: 960964884_960964885

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 960964884 960964885
Species Human (GRCh38) Human (GRCh38)
Location 3:123097806-123097828 3:123097825-123097847
Sequence CCAGGGCTGGTGGGAGGAAGAGA GAGAGTTATCCCTTCTTTGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 78, 4: 694} {0: 1, 1: 0, 2: 0, 3: 11, 4: 129}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!