ID: 961237112_961237114

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 961237112 961237114
Species Human (GRCh38) Human (GRCh38)
Location 3:125376100-125376122 3:125376146-125376168
Sequence CCTGAGGTGCTTCTGCATACTGC TGTGTACACACCCTAGCACAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 108} {0: 1, 1: 0, 2: 0, 3: 19, 4: 141}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!