ID: 961372738_961372752

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 961372738 961372752
Species Human (GRCh38) Human (GRCh38)
Location 3:126441296-126441318 3:126441348-126441370
Sequence CCCACCACCTTCAGCATAGAAAG TAGAAATGGGGTGGCTGAGACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 169} {0: 1, 1: 0, 2: 1, 3: 44, 4: 353}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!