ID: 961372739_961372746

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 961372739 961372746
Species Human (GRCh38) Human (GRCh38)
Location 3:126441297-126441319 3:126441335-126441357
Sequence CCACCACCTTCAGCATAGAAAGG AAGCAGGCCGCCCTAGAAATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 174} {0: 1, 1: 0, 2: 0, 3: 14, 4: 41}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!