ID: 961373599_961373602

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 961373599 961373602
Species Human (GRCh38) Human (GRCh38)
Location 3:126448050-126448072 3:126448077-126448099
Sequence CCAGAAAGGTGGGGACACGAGGA CACCTCACAGGATTGTTGCGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 178} {0: 1, 1: 0, 2: 32, 3: 241, 4: 1047}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!