ID: 961491195_961491211

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 961491195 961491211
Species Human (GRCh38) Human (GRCh38)
Location 3:127257816-127257838 3:127257867-127257889
Sequence CCAGACTTCCACAAAGACTCAGG CCTCCAGCTGTCAGGGCAGTAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!