ID: 962290978_962290981

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 962290978 962290981
Species Human (GRCh38) Human (GRCh38)
Location 3:134136119-134136141 3:134136145-134136167
Sequence CCAGGTCTCTTTACTGTCAGCTT CTACGCTGCCTGGCAAAAACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 206} {0: 1, 1: 0, 2: 1, 3: 7, 4: 104}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!