ID: 962318035_962318039

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 962318035 962318039
Species Human (GRCh38) Human (GRCh38)
Location 3:134370932-134370954 3:134370975-134370997
Sequence CCAGGGACAACTGAAGGAGCCGT CCCATGCCTCAGCTCCCGCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 73} {0: 1, 1: 0, 2: 2, 3: 21, 4: 377}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!