ID: 962481224_962481230

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 962481224 962481230
Species Human (GRCh38) Human (GRCh38)
Location 3:135800359-135800381 3:135800394-135800416
Sequence CCACTAGGGCACATCAGCCCATG AAGCCTCTCTCCAGCACCATAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!