|
Left Crispr |
Right Crispr |
| Crispr ID |
962588649 |
962588654 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
3:136866695-136866717
|
3:136866735-136866757
|
| Sequence |
CCTCCGTCTCCTTGGTTCAAGTG |
TTCCGAGTAGCTAGGATTACAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 5, 1: 470, 2: 10453, 3: 51683, 4: 119056} |
{0: 56, 1: 3661, 2: 62084, 3: 233001, 4: 266144} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|