|
Left Crispr |
Right Crispr |
Crispr ID |
962602357 |
962602364 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
3:137002843-137002865
|
3:137002881-137002903
|
Sequence |
CCATGCCTATGTCCTGAATGGTA |
TCTAGGACTTTTATGGCTTTAGG |
Strand |
- |
+ |
Off-target summary |
{0: 13524, 1: 7516, 2: 2647, 3: 1163, 4: 728} |
{0: 1, 1: 35, 2: 959, 3: 14339, 4: 7769} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|