ID: 962809210_962809226

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 962809210 962809226
Species Human (GRCh38) Human (GRCh38)
Location 3:138947048-138947070 3:138947099-138947121
Sequence CCCGCCCCCCGGTTTCCCGAAGC CCTGGAGTCCCTAGTGCGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 108} {0: 1, 1: 0, 2: 0, 3: 8, 4: 135}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!