|
Left Crispr |
Right Crispr |
Crispr ID |
962882468 |
962882473 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
3:139591315-139591337
|
3:139591362-139591384
|
Sequence |
CCTACGCCCACGGAATCGCGCTG |
CAAACTGCAAGGCGGCAACGAGG |
Strand |
- |
+ |
Off-target summary |
{0: 16, 1: 450, 2: 786, 3: 859, 4: 831} |
{0: 317, 1: 1166, 2: 1768, 3: 1553, 4: 836} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|