|
Left Crispr |
Right Crispr |
Crispr ID |
962882468 |
962882475 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
3:139591315-139591337
|
3:139591368-139591390
|
Sequence |
CCTACGCCCACGGAATCGCGCTG |
GCAAGGCGGCAACGAGGCTCGGG |
Strand |
- |
+ |
Off-target summary |
{0: 16, 1: 450, 2: 786, 3: 859, 4: 831} |
{0: 1, 1: 330, 2: 1210, 3: 1957, 4: 1748} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|