ID: 962882468_962882475

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 962882468 962882475
Species Human (GRCh38) Human (GRCh38)
Location 3:139591315-139591337 3:139591368-139591390
Sequence CCTACGCCCACGGAATCGCGCTG GCAAGGCGGCAACGAGGCTCGGG
Strand - +
Off-target summary {0: 16, 1: 450, 2: 786, 3: 859, 4: 831} {0: 1, 1: 330, 2: 1210, 3: 1957, 4: 1748}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!