ID: 963020814_963020819

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 963020814 963020819
Species Human (GRCh38) Human (GRCh38)
Location 3:140871519-140871541 3:140871559-140871581
Sequence CCACTTCCAGATAACAAGGAAGG AGCACATTTCAGGCTGCAGTAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 23, 4: 357} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!