ID: 963061935_963061948

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 963061935 963061948
Species Human (GRCh38) Human (GRCh38)
Location 3:141232486-141232508 3:141232521-141232543
Sequence CCTCTTGGCAGCCACCTGCAGCC GAGTCCCGGGCCTGGCCACGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 52, 4: 370} {0: 1, 1: 0, 2: 1, 3: 14, 4: 206}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!