ID: 963061940_963061957

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 963061940 963061957
Species Human (GRCh38) Human (GRCh38)
Location 3:141232507-141232529 3:141232549-141232571
Sequence CCTGACGCCTCCGGGAGTCCCGG CGAGCGCAGGTTAACATTCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 90} {0: 1, 1: 0, 2: 1, 3: 0, 4: 32}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!