ID: 963103074_963103087

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 963103074 963103087
Species Human (GRCh38) Human (GRCh38)
Location 3:141623840-141623862 3:141623882-141623904
Sequence CCGCCCAGCCTCAGTAAGGACTT CAGGTGACTCACTGGGCACCCGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 24, 4: 368}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!