ID: 963275973_963275983

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 963275973 963275983
Species Human (GRCh38) Human (GRCh38)
Location 3:143330060-143330082 3:143330088-143330110
Sequence CCCCATGCCTGGCTTAGACTCCT AGGAGACAGATGGTGAGGTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 232} {0: 1, 1: 0, 2: 3, 3: 75, 4: 712}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!