ID: 963310807_963310811

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 963310807 963310811
Species Human (GRCh38) Human (GRCh38)
Location 3:143708213-143708235 3:143708232-143708254
Sequence CCACTATCTGGGAGCATACCAGC CAGCCCATTCAGTTTGAAAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 54} {0: 1, 1: 0, 2: 0, 3: 18, 4: 315}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!