ID: 963605600_963605605

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 963605600 963605605
Species Human (GRCh38) Human (GRCh38)
Location 3:147409938-147409960 3:147409953-147409975
Sequence CCGCGCCATTGCCTGCAGGCTAG CAGGCTAGGACTTCGCGAGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 90} {0: 1, 1: 0, 2: 0, 3: 1, 4: 64}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!