ID: 963822079_963822084

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 963822079 963822084
Species Human (GRCh38) Human (GRCh38)
Location 3:149908662-149908684 3:149908697-149908719
Sequence CCAGCAGTTGGGCTGAATACAGG AAGCTGATCTATAGGACAGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 104} {0: 1, 1: 0, 2: 0, 3: 9, 4: 128}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!