ID: 963871728_963871732

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 963871728 963871732
Species Human (GRCh38) Human (GRCh38)
Location 3:150423025-150423047 3:150423076-150423098
Sequence CCATTTGATTCTCGGATCTCACA GTTCCATTTGAACACGTTAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 131} {0: 1, 1: 1, 2: 0, 3: 11, 4: 69}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!