ID: 964029762_964029763

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 964029762 964029763
Species Human (GRCh38) Human (GRCh38)
Location 3:152123980-152124002 3:152124031-152124053
Sequence CCAAAAAATTAAAGAAAGAAAAT GCCATGACTTCAACTATAAATGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!