ID: 964060716_964060718

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 964060716 964060718
Species Human (GRCh38) Human (GRCh38)
Location 3:152518833-152518855 3:152518865-152518887
Sequence CCATCCATTGTTGTCTAGTGCAC TATACTTTACAATATAATATCGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 7, 3: 63, 4: 512}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!