ID: 964589055_964589065

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 964589055 964589065
Species Human (GRCh38) Human (GRCh38)
Location 3:158340594-158340616 3:158340645-158340667
Sequence CCATGATTTTGAGGCCTCCCCAG CTCTTTCTGTTCCCAGTGTCGGG
Strand - +
Off-target summary {0: 151, 1: 5462, 2: 6800, 3: 4287, 4: 2373} {0: 1, 1: 5, 2: 109, 3: 856, 4: 1466}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!