|
Left Crispr |
Right Crispr |
Crispr ID |
964589057 |
964589065 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
3:158340608-158340630
|
3:158340645-158340667
|
Sequence |
CCTCCCCAGCCATGTGGAACTGT |
CTCTTTCTGTTCCCAGTGTCGGG |
Strand |
- |
+ |
Off-target summary |
{0: 3882, 1: 6620, 2: 7728, 3: 6299, 4: 4106} |
{0: 1, 1: 5, 2: 109, 3: 856, 4: 1466} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|