ID: 964589058_964589065

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 964589058 964589065
Species Human (GRCh38) Human (GRCh38)
Location 3:158340611-158340633 3:158340645-158340667
Sequence CCCCAGCCATGTGGAACTGTAAG CTCTTTCTGTTCCCAGTGTCGGG
Strand - +
Off-target summary {0: 1791, 1: 5734, 2: 7090, 3: 7321, 4: 5798} {0: 1, 1: 5, 2: 109, 3: 856, 4: 1466}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!