ID: 964767744_964767751

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 964767744 964767751
Species Human (GRCh38) Human (GRCh38)
Location 3:160195148-160195170 3:160195175-160195197
Sequence CCCCTGTGAAAATAATTCTTGCA CACCCAGATTTTTCTGCTCCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 25, 4: 251}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!