ID: 964767744_964767751 |
View in Genome Browser |
Spacer: 4 |
Left Crispr | Right Crispr | |
---|---|---|
Crispr ID | 964767744 | 964767751 |
Species | Human (GRCh38) | Human (GRCh38) |
Location | 3:160195148-160195170 | 3:160195175-160195197 |
Sequence | CCCCTGTGAAAATAATTCTTGCA | CACCCAGATTTTTCTGCTCCAGG |
Strand | - | + |
Off-target summary | No data | {0: 1, 1: 0, 2: 1, 3: 25, 4: 251} |
Status | Not started |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer | Left Crispr | Right Crispr | ||||||
---|---|---|---|---|---|---|---|---|
Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
No off target data available for this pair! |