ID: 964881499_964881504

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 964881499 964881504
Species Human (GRCh38) Human (GRCh38)
Location 3:161428356-161428378 3:161428371-161428393
Sequence CCTTCCACCTCAGCCTTCCACAG TTCCACAGTGCTAGGATTACAGG
Strand - +
Off-target summary No data {0: 7, 1: 1260, 2: 37086, 3: 334400, 4: 250984}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!