|
Left Crispr |
Right Crispr |
Crispr ID |
964881499 |
964881504 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
3:161428356-161428378
|
3:161428371-161428393
|
Sequence |
CCTTCCACCTCAGCCTTCCACAG |
TTCCACAGTGCTAGGATTACAGG |
Strand |
- |
+ |
Off-target summary |
No data |
{0: 7, 1: 1260, 2: 37086, 3: 334400, 4: 250984} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|