ID: 964901223_964901228

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 964901223 964901228
Species Human (GRCh38) Human (GRCh38)
Location 3:161660899-161660921 3:161660930-161660952
Sequence CCAGAGTAGGTGTGAAAGCTCAG GCGGTTATGGTGTTTTATGCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 0, 4: 48}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!