ID: 964949589_964949592 |
View in Genome Browser |
Spacer: 0 |
Left Crispr | Right Crispr | |
---|---|---|
Crispr ID | 964949589 | 964949592 |
Species | Human (GRCh38) | Human (GRCh38) |
Location | 3:162273480-162273502 | 3:162273503-162273525 |
Sequence | CCTTCAAATAGACCTTTAGAGAA | AGTCTAAGTGGACAATAAGCAGG |
Strand | - | + |
Off-target summary | No data | {0: 1, 1: 0, 2: 0, 3: 5, 4: 92} |
Status | Not started |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer | Left Crispr | Right Crispr | ||||||
---|---|---|---|---|---|---|---|---|
Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
No off target data available for this pair! |