ID: 964949589_964949592

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 964949589 964949592
Species Human (GRCh38) Human (GRCh38)
Location 3:162273480-162273502 3:162273503-162273525
Sequence CCTTCAAATAGACCTTTAGAGAA AGTCTAAGTGGACAATAAGCAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!