ID: 965017191_965017196

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 965017191 965017196
Species Human (GRCh38) Human (GRCh38)
Location 3:163173246-163173268 3:163173291-163173313
Sequence CCTGAAGAGTGTTTTCCAACTCG CAGGTACACCAATTAAATGTAGG
Strand - +
Off-target summary {0: 12, 1: 1240, 2: 6206, 3: 2362, 4: 939} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!