ID: 965134357_965134364

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 965134357 965134364
Species Human (GRCh38) Human (GRCh38)
Location 3:164742144-164742166 3:164742171-164742193
Sequence CCTCATTTGCCCAGCCTGCTTCT GGACAAGGTCCTGCTCACCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 36, 4: 349} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!