ID: 965144236_965144241

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 965144236 965144241
Species Human (GRCh38) Human (GRCh38)
Location 3:164879031-164879053 3:164879073-164879095
Sequence CCTCATCTTACCCACTCTCTCTC ATGCCCTTTAACCAATTGAATGG
Strand - +
Off-target summary {0: 5, 1: 3, 2: 28, 3: 95, 4: 909} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!