ID: 965708642_965708646

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 965708642 965708646
Species Human (GRCh38) Human (GRCh38)
Location 3:171534770-171534792 3:171534801-171534823
Sequence CCCAGTAGCAGGCCAAGAGCTGC AGGAGAGTAGTTATCTGCAGAGG
Strand - +
Off-target summary No data {0: 5, 1: 11, 2: 22, 3: 42, 4: 203}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!