ID: 965872472_965872480

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 965872472 965872480
Species Human (GRCh38) Human (GRCh38)
Location 3:173278427-173278449 3:173278469-173278491
Sequence CCTTTCTCCCTCTATACCTACAA GGTGTTCTAACCCAGTCTAAGGG
Strand - +
Off-target summary No data {0: 9, 1: 14, 2: 7, 3: 10, 4: 95}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!